The Archives

Sayanee's blog 2005 - 2012. Checkout her latest blog!

DNA Sequence

11 May 2007 on learning

There are 23 chromosones in each of the human cell and nucleotides are the basic structure of these chromosoes. 4 nucleotides that make up all the DNA molecules:

  1. A - adenine
  2. G - guanine
  3. T - thymine
  4. C -  cytosine

and here's the interesting bit. From gutenberg data we can actually download the series of these nucletides in the exact order form the Human Genome Project. Looking at the loooooooong sequence it already made me think ... woow!! it's so so long... and it's only these 4 nulceotides that has written the course of human and animal destiny and make up... amazing! Here a tiny part of chromosome 1... check out the full sequence!

GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACAC TGGGCTGTAGGAGTGATGGGGTTCACCTCTAATTCTAAGATGGC TAGATAATGCATCTTTCAGGGTTGTGCTTCTATCTAGAAGGTAG AGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATAC GCATGTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATT TATTGTACATTTTTAAATAGCTAGAAGAAAAGCATTGGGAAGTT TCCAACATGAAGAAAAGATAAATGGTCAAGGGAATGGATATCCT AATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAA TATCACACATACCTTCAAACTATGTACAAATATTATATACCAATAA AAAATCATCATCATCATCTCCATCATCACCACCCTCCTCCTCATCAC CACCAGCATCACCACCATCATCACCACCACCATCATCACCACCACCA CTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATC ACCACCACTGTCATTATCACCACCACCATCACCAACATCACCACCAC CATTATCACCACCATCAACACCACCACCCCCATCATCATCATCACTA CTACCATCATTACCAGCACCACCACCACTATCACCACCACCACCACA ATCACCATCACCACTATCATCAACATCATCACTACCACCATCACCAA